CB250304

Overview
NameCB250304
Unique NameCB250304
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length213
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7942 contig Csv1_Contig7942:623..835. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionEST0088 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ123 similar to beta-caroteine hydroxylase (acc# AAG33636), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250304 ID=CB250304|Name=CB250304|organism=Citrus sinensis|type=EST|length=213bp
CGGCCGAGGTCTTTTTTTTTCATTTGCAGGTGGGCATGGAGTTTTGGGCA
CGATGGGCTCATAAAGCTCTGCGGCATGCTTCTTTATGGCATATGCACGA
GTCTCACCATCGACCAAGAGAGGGTCCTTTTGAGCTAAACGATGTGTTTG
CCATAATCAACGCAGTTCCAGCCATAGCCCTTCTCTCTTTTGGCTTCTTC
CACAAAGGCCTTG
back to top