CB250307

Overview
NameCB250307
Unique NameCB250307
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length146
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9371 contig Csv1_Contig9371:740..885. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionEST0091 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ127 similar to arabinogalactoprotein AGP(acc# AAB35283), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250307 ID=CB250307|Name=CB250307|organism=Citrus sinensis|type=EST|length=146bp
ACTACTATGATGTCCAGAATGAGAACAATAATTTTCCTGCCGGGTTTGAA
TCTGAGAAGGGAACTACTACAAGTAGAGGTTACTATGGAAATACACAGAA
TGTAAATGAGTTCAGCACCATGGAACAATTTGAGAACCAGCAGGAG
back to top