CB250312

Overview
NameCB250312
Unique NameCB250312
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length345
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Properties
Property NameValue
Genbank descriptionEST0097 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ135, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250312 ID=CB250312|Name=CB250312|organism=Citrus sinensis|type=EST|length=345bp
ACTAATTTGCTTCTATATATTATTATAATTTTAAAAGATGTAGTTGTTAG
AATAAATAAAGAAAGTGCACCAAGGTTTTTAGATGCACGTGAAAGCTTGA
GTGCACACAATCACTATGGTGTGTGCATAGTGATTGTGTGCAGGAGGGTG
GTGAATTGAGGAGCTGGTCGGAGCATATGCTGAAGAGACATGAGAATTCA
ATGAGATTTTGCTCATATGATGCTGCCTTTCGGCTAGCTAACTCATATAT
ACATGGTTTTAGAAGATTGTATGATGGCGTATGGATTTATACCTTTCGTT
CTTTTTGTTGTAGAAGGTTTGCAAATTTAAAGTGATTAATGATAG
back to top