CB250313

Overview
NameCB250313
Unique NameCB250313
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length147
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Properties
Property NameValue
Genbank descriptionEST0098 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ136, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250313 ID=CB250313|Name=CB250313|organism=Citrus sinensis|type=EST|length=147bp
TCCATTTTCCGATGGATTCCGAGCTCGACGACGCCGGCCGCGACAATGGG
TGGAAAGCCAAGAGCAGCGACGAGGAGGAGTATGAATAAATTTGGTAGGT
CATGATGGTTATTGCAGCATTAGGGCAACTATGATCTTTGGCAAATG
back to top