CB250314

Overview
NameCB250314
Unique NameCB250314
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length352
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionEST0099 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ137 similar to unknown Arabidopsis protein (acc# T04914), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250314 ID=CB250314|Name=CB250314|organism=Citrus sinensis|type=EST|length=352bp
ACAAGTATTACATTCACACCCAAGATGCTGCTGTTAAACTGCTCGCAAAA
ATGTATGTAGCCTCCATTTTCCTTGGTAGTTTGTGCTGGTTGGGGGATCG
CCTCTTCTGTGAAGAGGTATCTGGTTGGCCTGTAAACCCTCAGGGTCACG
CCTTATGGCATGTTTTCATGGGATTCAATTCTTATTTTGCAAACACATTC
TTGATGTTTTGCCGTGCCCAGCAACGAGGATGGGCTCCAAGAGTGGTCTA
TCTAATGGGGATTTTGCCGTATGTGAAGATTGAGAAACCGAAATCCCAGT
GATAGAAGTGAGAATGAATCGTTGAGAGTATACTTTTTGTTGTTATTGAA
GG
back to top