CB250320

Overview
NameCB250320
Unique NameCB250320
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length354
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionEST0107 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ156 similar to unknown Arabidopsis protein (acc# NP_197058), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250320 ID=CB250320|Name=CB250320|organism=Citrus sinensis|type=EST|length=354bp
ACCCATTTGTTACAAAGAGATGCTCAGAAGACCACCTATGAGAATGGAAT
GGTTGATCAGGAATCAGCTGAGCCTGTTTTCAATCACATGACCTCAATGG
ATTTAAATGGGACAATTAAGGAAGAGCCTGCTGCTCAGCCTATTTTCTAT
CATATGTCATCAATCGACTTGAATGGAACAGTGCAACCGGAACCCAATGA
TCAACCACTCTTACATCGAATGCCTCCATTGGAGGCAAAGGTGCATGTCA
TGAGTTCGGGTGAACCACGTGACATCCCCAAAGATGATCTTCAGAAAGTT
CAGGTTGACTGTATTTCGGCTACTGCACTGCAACTTCTTCTGAAGCTGAA
GAGG
back to top