CB250325

Overview
NameCB250325
Unique NameCB250325
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length265
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionEST0112 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ162 similar to spliceosome-associated protein homolog (acc# T05841), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250325 ID=CB250325|Name=CB250325|organism=Citrus sinensis|type=EST|length=265bp
ACTCCCACTGGTGTTGAAACACCTGATGTTATTGACCTTCGTAAGCAGCA
GAGGAAGGAACCTGAGAGGCCTCTATACCAAGTTCTTGAGGAAAAAGAGG
AGAGGGTTGCTCCTGGGACATTACTTGGAACAACACACACTTATGTGGTC
AACACCGGCACACAAGACAAAGCAGGAGCTAAAAGGGTTGATCTGCTTAG
AGGCCAGAAGACGGATAGAGTTGATGTTACCTTGCAGCCGGAAGAGCTTG
AAGTTATGGACAATG
back to top