CB250341

Overview
NameCB250341
Unique NameCB250341
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length321
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9570 contig Csv1_Contig9570:222..542. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionEST0131 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ195 similar to unknown Arabidopsis protein (acc# NP_197909), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250341 ID=CB250341|Name=CB250341|organism=Citrus sinensis|type=EST|length=321bp
ACGAGTAGTGCCAATTAGAACCATGGTAGCAGCCGTTCCAGCTCCCTTTG
GGCGCCTACCTTCAGATTCATCTAGTAATCCTGTCAGCTTATATTATCCG
GTTCTTGGAAGATTTCAGCATGTAGCTTCTGGACTTGTGAGTGGTGAACA
GGGACATCAAGTATCTGGTGAGCATCATCCTGCTGGACTGCAAACTGAGC
AGCCATCAGTTCCTGATTCTATAGGGCAACAAAATGCTGAAGATCCTGCA
CGAAATGGATCATTGGCAAATCCAAACTCCAGACAACAGGAGGCATCTCA
CTCACACAGTGTCAATGTTGG
back to top