CB250345

Overview
NameCB250345
Unique NameCB250345
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length379
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig115 contig Csv1_Contig115:581..961. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionEST0135 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ199, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250345 ID=CB250345|Name=CB250345|organism=Citrus sinensis|type=EST|length=379bp
ACCAACGCTGATGGATCGGCCTCTGGATTTGTTCTTCCAAATAGTTGCTT
GAAGACTTGAAGTTGAGAAAAATATTTGAGTTGAAAAAAAGTAGGCATAA
GAAGCCGATCGTGATTATAATATTAAAGTAAAAGATATAAGCAGTAGAAT
TTTGCTGAAGTTACTAAATTTGTGATAGGCAGCCATTAACAACAGAAAAA
AATCATAGGAAGCCGATCATTTTACTTTGAACTAAGGTTTTTCGGTGATC
TGTAAATTTACGCCCATTGGGCTTACTTAGAGGCAGTTCCTACAATGTGT
TGAAAGTATCGCTGTTGCTTTCGCAAGTAGATGTTCATAATGTTATGGAA
TATATTAATTTACTTTAAAAAAAAAAAAA
back to top