CB250357

Overview
NameCB250357
Unique NameCB250357
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length184
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Properties
Property NameValue
Genbank descriptionEST0151 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ220, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250357 ID=CB250357|Name=CB250357|organism=Citrus sinensis|type=EST|length=184bp
TGATCGGATAGACAGGGTAGCCTTGGTTCAGGTGTTCGTGATATCGACAT
TACTGTGACTATGTCATCAAGAGGGTCTCTTCATTCAACTAGTAGACTTC
GACGTCGACAATCGTTACGAAATTTACGGAACTGAGCCTTTAAGAGCATA
TATCCTACTGTTTGACCACGAGATTGTTTTATAC
back to top