CB250366

Overview
NameCB250366
Unique NameCB250366
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length291
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
CB250366_ssr117 microsatellite CB250366_ssr117:117..128.
Properties
Property NameValue
Genbank descriptionEST0162 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ236, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250366 ID=CB250366|Name=CB250366|organism=Citrus sinensis|type=EST|length=291bp
ACACACACATAAAATTACAGACCTTGTGTCAAAGCAGAACAAAATGTAAG
AGTCAAGATCATTGAGTAGTCATCAATGAGCTTGACTGAGTAAGAATAAA
ATGGATAAAGAGTATATGATTGATTGATCAAGTCAATGAAATAATTAAAC
AGAGGCAACCACCGCACTCAACTTATGTGCTGGGTGTCTTTTATCATTTT
CTTATGTGATTTATTTTTCTTATGTAATTTATTGTTGTAACTTCAGTGAA
ATAAATATTCCATTTCTTGTTGTTGAAAAAAAAAAAAAAAA
back to top