CB250367

Overview
NameCB250367
Unique NameCB250367
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length357
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionEST0163 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ238 similar to protein kinase-like protein (acc# NP_190600), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250367 ID=CB250367|Name=CB250367|organism=Citrus sinensis|type=EST|length=357bp
CTGGTGTCCTCTGTTTTCTTTCTTCTTTTTAATCCCTCAAACTCAGGCTC
GAGATAAAAAATTAGCTTTACAAAAATAAAAAAACCCTCCCTGACGGCAA
TGGAGTGGCTTCGAGGAGACGTAATTGGTCATGGAAGTTTTGGGAGTGTG
AATCTTGCAAAGGCCTCAAAGGTTTCTTCTGAGTTTCCATCTTTAATGGC
AGTGAAATCTTGTTCTGATTGTCCGTCCAGTAGTGTTACTTTGAAGAACG
AAAAGGAGGCGCTTGATCAGATTGGTATTTGCCCGCAAATCGTGAGATGC
TTTGGCGATGATTACAGTTTTGAGAAGGGCGAAAGATTTTATAATCTGTT
GTTAGAG
back to top