CB250368

Overview
NameCB250368
Unique NameCB250368
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length379
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig122 contig Csv1_Contig122:1..379. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionEST0165 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ240 similar to putative transcriptional regulator (acc# AAG51964), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250368 ID=CB250368|Name=CB250368|organism=Citrus sinensis|type=EST|length=379bp
ACTTTTGTCACAAATGGAAATGGTCAGCAATTGATGTCATGATAATGGCG
ATTTCACATAGTTTAATGAGCATCCCAACGGCGATGCACATTTCTACTCT
CAGCCAATTCGAATCTGGCGTCAAGTCCAAGCTATTTGTTTCAGCTTCTC
CTTCTTTAAGACGGCCCAAAAGAGTTTCCTTGTCAGTAATTCGCGCCATG
GGCTCCTCTGCTTCTTCCCAGAAACCCGACAACATTCAAGAGGCCAACAG
GGTTGATTATGCTTCTATAAGTGATGAAGAGTGGAAAGGAAGGCTCACAG
GGGAGCAATATTACATAACTCGACAAAAAGGGACTGAGAGGGCTTTTACG
GGGGAATATTGGAACACCAAAACCGCTGG
back to top