CB250379

Overview
NameCB250379
Unique NameCB250379
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length669
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5615 contig Csv1_Contig5615:48..716. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionEST0181 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ261 similar to unknown Arabidopsis protein (acc# BAC43320), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250379 ID=CB250379|Name=CB250379|organism=Citrus sinensis|type=EST|length=669bp
AAAGTTTGGCAACCAATGTTAATGTGGAAGCTAATTCTGCTGAGAAGGCC
TTAGTGCTTCCTAAAGAAGATAATGTTGCAACAGCACCTTTATCAATACA
GGAGATATCTGCCCAGGCTTCAAAGCCAGAATTTGATCGTTACAAGGCTT
TTACAGAATCGATCATAGAGCACAATTATAATCTGCAAACAGATCAGCAG
GAACAAATCAGGAACACATCAAAGCCTTCTGGTTCTCAATCATCAAAGCC
AGTGTCCAGATTTAAAATGCAGAGGAAGTAGTTGCCAAAGTAGCTCTAGG
CTGTAGCATGTAAAAGATATGGAAAAATCAGAAATGTGAGAATGCGTCCG
TGAAATTTTGTATTCTAGAACAGAAAACAGAAACTCCTTTATTTTGAAGT
AGATTGCCAGATCTGTTACCTGCCATTGTTATAAATAGTTCTCAACCAAC
CCCCTTTAAGTTCTCTTGATATTTTGTGCTTAGGAAAAAGCTCGACCTAA
GTCCATATTTTGCCAATCCTACTATTGATTGTAACTTCAACTATTTACCA
CTGCGCCAAGGGCCACTGTTGATAAAATTTACATCAAAAACTATTTNGCC
TTTAATTCTATCCTAATTTATTTTGGAATCAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAA
back to top