CB290192

Overview
NameCB290192
Unique NameCB290192
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length812
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS01_01aa02_b1 Washington Navel orange cold acclimated flavedo & albedo cDNA library Citrus sinensis cDNA clone UCRCS01_01aa02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB290192 ID=CB290192|Name=CB290192|organism=Citrus sinensis|type=EST|length=812bp
TTAAAAAATACCCATTTCAATATATTAATAAACAAAAAAAGGTCTCTAAT
GTATTAAAATCAGTATTTTTTTAATATTTTAATGACATCCTCACTTTAAC
AAACAAAGTGAGGATGCCCTCGTTAAAAAAGGTCTTTGATAGCTACATAT
ATGGCTGGTGAGAAGGCTGCAATCCACTACCTGCATAACCGTTATAATTA
GCTGGAGCCGCATTGTATGAGTTCGGAGCAACCCTATCATCTTGGGGATA
GTAGTATAATCTTTGATCATTTATTTGTTGAGCGTATGCAGACTGACCAG
AAACTTGATAATCATAATGATTTGAAGCAGCCTGATGATACCTTGCTGGC
ATTGCTCCATAAACAGTCCTGTCAGCATAAACAGGTGGAGCCTGCCTGCT
GGAAGCAGCATTGCCGCCAGAAGCACGGAATCCACGATATCCTCCGTTGG
CTCTGTGCTTCTTGGACTGTTGATGTTTACTAAAATCTCTACCCCTCTTC
TTATCAGATTTGGACCTCTCCAGCTGAGCAACCCTTTTCTGAAGTGGATC
AAGTGGGTACTCAGCTTCAAGCTTGTACCGTTCAATACAACTGATGACAG
CCTTAAGAGCTGCAAGTTCTTGTGCGTTTGCGTCATTCTGTGCACCAGTA
GCGCCGCCTGAATTCCCACCCTTTCCTTGTGAATTTCTCCTCAAATCCTT
CAAGTACGTCTTCAGGAGGGGCACAGGAGGAAAGTTTTCAGTAAGCTGGA
AAGCATGAATCAAATGTACAGCATCAATTTGCTTCGCATTGTTTACCAAA
ATCTCGATAATC
back to top