CB290292

Overview
NameCB290292
Unique NameCB290292
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length523
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CB290292_ssr42 microsatellite CB290292_ssr42:42..53. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig5233 contig Csv1_Contig5233:92..614. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS01_01af02_b1 Washington Navel orange cold acclimated flavedo & albedo cDNA library Citrus sinensis cDNA clone UCRCS01_01af02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB290292 ID=CB290292|Name=CB290292|organism=Citrus sinensis|type=EST|length=523bp
CCCCNCGAGTTTTTTTTTTTTTTTTATAATAAGATGTCTGCATATATATA
TATACTTTATTTGGAAGATTATTTAGGTTATGCACTCGTCAAACACTGTA
TCATGAGTACATAGCTGTTTTATACAGAAGGAAAGTTCACTGTCTGATAG
TGATACATATTGGCCTTGGTTGCTTATAATGATTTTAGCATGCTCCTAGT
GCAGCTTCCCATGTCCGGAATGAAGCTGAAGTGTCCTGCTCGGAACAACT
TGAAGAACACCGGGTTGTTTGGAAATCTCATCAACTTGCTGAGGAGTAAG
CTTAGCCGAGAATCCACTGGCAGCCGTCTTATAACTGTACAACAGAGCAT
CCTTTGCAGCCTCCTGACTGCCGAGGACGGAGGAGAGGATACGGAGGTGG
AAGGACTCGGGCTCCTCGTCCTGTGGCCTCTCCGTGTAAACGATCTGAAC
CGCCGATTCCGCTTGTGGTGGTGCCGTCGTCTCCGCCATTTCGACTATCA
GAATCCACAAAATGACCCTCGTG
back to top