CB290295

Overview
NameCB290295
Unique NameCB290295
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length728
Alignments
Feature NameTypeLocationAnalysis
CB290295_ssr527 microsatellite CB290295_ssr527:527..544.
CB290295_ssr401 microsatellite CB290295_ssr401:401..412.
CB290295_ssr433 microsatellite CB290295_ssr433:433..444.
CB290295_ssr715 microsatellite CB290295_ssr715:715..726.
Csv1_Contig385 contig Csv1_Contig385:197..924. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionUCRCS01_01af03_g1 Washington Navel orange cold acclimated flavedo & albedo cDNA library Citrus sinensis cDNA clone UCRCS01_01af03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB290295 ID=CB290295|Name=CB290295|organism=Citrus sinensis|type=EST|length=728bp
GCCCGTGGCATTGAAAAGAAAAGAAGAGGAACAGAGTCATTTCATGGGAA
AATGTCAGGAGTTATTCACAAGATCGGAGAAGCCCTTCACATGGGAGGAG
GGCAAAAGGAGGAGGACAAGCACAAGGGAGAGCACCATAGTGGGGACCAC
CACACTACTGATGTCCACCATCAGCAGCAGTATCACGGCGGCGAACACAA
GGAGGGCTTGGTGGACAAGATCAAGCAGCAGATCCCCGGTGTCGGCACTA
CTGATGTTCACCATCAGCAGCAGCATCACGGCGGGGAACACAAGGAGGGC
GAACACAAGGAGGGCTTGGTGGACAAGATCAAGCAGAAGATCCCCGGTGT
CGGCGGCGGCGAGGGCGCCGCCCACGGTGAAGAGAAGAAGAAAAAGAAGG
AGAAGAAGAAGAAGCACGAGGACGGACACGAGAGCAGCAGCAGCAGTGAC
AGCGATTAAATTAATTAACTTTTATGTGACGCATCCATCATCCATCATCT
TAGATTTATTCTATAATAAAAGTTTGGTGTGTGTGTGTGTGTGTGGTCAC
AGTAAGAGCTTGCTGCTTTATTTTTGGGGTGTCTCCTTAAGGTGGTGTTA
GTGTTTAAATTATTGCTTTTGAGAGAGACTGTTTTTTATTCTGCCCAGTC
AGTGTGTAATTTGCCTTTTGTCAATGTGAATTTCCATTATCAATTATATG
ATAAAAGAGATTAGTTATTATTATTATT
back to top