CB304386

Overview
NameCB304386
Unique NameCB304386
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length577
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIIaR_A11 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIIaR_A11 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304386 ID=CB304386; Name=CB304386; organism=Citrus sinensis; type=EST; length=577bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGGAGGAAACGAATTTTAGA
ATTTATTGGACACTCTGATTTAGACTTTATTGCATTGTACTAATACGAAA
TGCGAAGATTAATGAAAGCCCAAAATAATTTTTGCTGCTTTGGCTGGCTC
AAAAGCTCCAACAACAGTTTCTCATCAATAAGATGTCTTGGATGCTCTCT
CCTTCGACGGGGAGGAATGTGACCAGCTCAGACATGATGGAAAGTGCAGA
GCAGTTGGAAACCCATGGCTTTGAACGCATTTTGCAAACCTGACGGCCTT
GAGGAGTAATTCAATTTGTCTTCATCTGACTCTGAGAATGACTCAAAACA
AATCTATATAGCTTTGTCTGGAGTTTTAGTTCATTCCAAAGTTCAATTCA
ATCGCGTATCCACTACTGCTTTGTAGCATATAACTGACAGGTTATTGACG
GGGTGCTTCCGGTGTCTCAGACAACTTGAGGAGATCTACTTCATCACCAT
GAAGAATTTTGTCCATGAGTTGATTTATGATATTTCCTTTAGCCTTTATC
CCAACAGCAATTGCCGTTTTTAGCTTG
back to top