CB304508

Overview
NameCB304508
Unique NameCB304508
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length328
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5695 contig Csv1_Contig5695:537..864. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIaR_G12 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIaR_G12 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304508 ID=CB304508|Name=CB304508|organism=Citrus sinensis|type=EST|length=328bp
TTTTTNNTTTTTTTTTTTTTTTTTTTTTTTCGAAACGGAAAAGGGTGATT
TATTTAAAGAATTGGCATGGGAAAACAGAGATTTACATACAACACCACCA
TAATTCATACACAATAATTAGCCACGGAAGAAACATGACGTGCGCTTCAA
GTATTAAAAATAGGGTCTTGTTATCATTTCAAGACTCTGCAGTCCGCATA
TCACTGGAAAATTGGACTTAACTAAACAAGGGTACTGCCTTTAACAAACT
CAGTGACAGCCAAAGCAACAAGACCCATCATAGCGAACCTCCCATTCCAC
AACTCAGCATCCGAAGTCATGAACCCCC
back to top