CB304511

Overview
NameCB304511
Unique NameCB304511
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length557
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
CB304511_ssr322 microsatellite CB304511_ssr322:322..333.
CB304511_ssr244 microsatellite CB304511_ssr244:244..263.
Csv1_Contig4460 contig Csv1_Contig4460:2..558. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIaR_H04 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIaR_H04 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304511 ID=CB304511|Name=CB304511|organism=Citrus sinensis|type=EST|length=557bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTACTCAAAGTTGAAATGACTCT
TTGGCAGATATTAAACTCTTGAAAAAGATTGGAATTAACAAAACCATATG
GGTTCTGCACTTAACAAATTGCACTGTGCTTCTAAGAATATTGTTAATAG
TTCACAAGTTCTTTTGCATACAAAAGATTTGAAACTCGCCATCTTCAAGT
GACAACAGAATAGGAAGATATGACACGCAACAATGACAAGTTACTCAGCT
CAGCTCAGCTCAGTTTTTCTCGGCATTGTTCTCCAGTTCCCTCCTCAGCT
GCAGAGAGAAGTCATCGTTGACATCATCATCATCCCAATCATCTTCCCAC
TGCTGCGTTACTTCATTCCCTTCCTCCTTTTCCTCCCACTCTTCGTTGAT
TTCAAACTCTTCAAACTCATCGTCGTCTTCAAACAAGTCGATCTTCGCAT
CTTCGGTCACTGTCTTCGGTTCGGCCGCCATTCTAATGCTCACAGAAGAA
CAACAGATTGATTTTTACAATTAGGGTTTCGTTGGACGATCCTAGAACGT
TCTAGTT
back to top