CB304515

Overview
NameCB304515
Unique NameCB304515
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length657
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig348 contig Csv1_Contig348:1..657. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IVaR_A01 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IVaR_A01 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304515 ID=CB304515|Name=CB304515|organism=Citrus sinensis|type=EST|length=657bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTAAGGAAATTTTCACAGGT
AACCATTCACATATTTGTAAATGTATCCGAACAGCGTAAACAGCGCTTCA
AATTTTCATCTGGAAACTGTATAAAACTCGTTTTTGAGATCTACATGAAT
TGAAAGCAACATAGTAAAGACTGACCTACCAAAATCGACAGTCAGTCCGT
CTTTGCAGTATATTATTCTTGGAAACCAAGACTATGAATCCTACAAATTA
TAGGAGACCTAGCGATTTCAGCTGCTGAACATGCTCAGGGGGGAGAGGTG
CCGGAGACCAATCAAATCCTGTCATCTCGCCATCAACATCCTCAACAACA
TACTCTTTTGTTAGCATTCGTTTTGCAAGTATGTGATAATGCCGCTGCCA
AATCCGCTGTCCAACCATTGTGGCCACCAAAACACTGTAGAATATTCCAA
TCACAGTAAACAATCCCAGCACAATCAAAGCCATTATGAATAGTAGCGGT
AGCCCTGCTTCACCAGCACCGCTCAGGCAACCGCATTCACTTGCTGTACT
CGCACAACTCTCAAAGCATGTGGTACAGTCAGTCCACATACAAAGCGTTC
CAGGCAAATGGCAGTCTGCACATATTCCGGGCTGACAGCAACAAAGACAT
AATTCTC
back to top