CB304524

Overview
NameCB304524
Unique NameCB304524
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length232
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12816 contig Csv1_Contig12816:931..1162. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IVaR_B02 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IVaR_B02 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304524 ID=CB304524|Name=CB304524|organism=Citrus sinensis|type=EST|length=232bp
TTTTTTTTTTTTTTTTTTTTNNTTTTTTTTTCCTGATAAAAAACATAATA
CCACATCAGCATAATACTCACACATATCCATGCAAATAGCTACGACATAT
GTAGCATAAACAAGTACAAAATATCCATATTGTGAACCCAACCACCTCTA
GAACAACAAAGGAATAAAACAGGGTTCAAGCCAACACTGGATAACAGTTT
CATAACACCTAGATAAAATACTTTCTACCAAA
back to top