CB304525

Overview
NameCB304525
Unique NameCB304525
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length138
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IVaR_B03 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IVaR_B03 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304525 ID=CB304525|Name=CB304525|organism=Citrus sinensis|type=EST|length=138bp
TTTTTTTTTTTTTTTTTTNNTTTTTTTTTTGCAAAGCAATAGTTGGCACG
CTCTTTAGCTTCATTTATCCTACATTTAATTAGTCTCCAAAAAGCTATTT
AAACAAAATTCAAGTCTCTTAAAAGAGGGAAAAAAAAA
back to top