CB304526

Overview
NameCB304526
Unique NameCB304526
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length239
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2135 contig Csv1_Contig2135:539..776. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IVaR_B04 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IVaR_B04 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304526 ID=CB304526|Name=CB304526|organism=Citrus sinensis|type=EST|length=239bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAAAAGAACTGTAATTCATTT
CATTTTTTTTTTTCAAACAATTAACCAAACAGGGAGAACGAAACAACACA
GGATAACAGGAACCGATCAAAACGACACATCATAACCCAAGGAAAATATC
AAAACACGGAACGGTAACATTCAACTCCTAATTTATCCTACAAAACCCTA
GTTCCTCCAGCTACCGCCATCAGAAGCACCGCTCCTTCC
back to top