CB304531

Overview
NameCB304531
Unique NameCB304531
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length207
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
CB304531_ssr53 microsatellite CB304531_ssr53:53..62.
Csv1_Contig9005 contig Csv1_Contig9005:185..391. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IVaR_B11 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IVaR_B11 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304531 ID=CB304531|Name=CB304531|organism=Citrus sinensis|type=EST|length=207bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTCGATAATTGTTTGTTGCTA
AGTATATATATAATGATAAGAATTATTTGTAGATCTTTTCACCCCATAAC
CTTGAATGGAACACTGTTTTGTCTAAACTAAAATAAAACTTTGTAGCGTT
ACGTTTACATAATAAACCCAATGCTATATACTCCACAAACTACAAAAGAA
ACAGGTC
back to top