CB304534

Overview
NameCB304534
Unique NameCB304534
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length598
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CB304534_ssr109 microsatellite CB304534_ssr109:109..120. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig10332 contig Csv1_Contig10332:106..703. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IVaR_C04 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IVaR_C04 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304534 ID=CB304534|Name=CB304534|organism=Citrus sinensis|type=EST|length=598bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGAATTCAATACCAAATATCA
AGGTTCTGTGGTTTCCCATAAAAATTATTAATGGGAATCCTTGTAGGGGA
TTACAGCTTCATCATCATCACCAAAAGAAAAGGACAAAGTTCAAAGCTGA
AAATCCATTAAATGGCAATCCAAAGGCAAAGCACTTATGCGCCCATCACG
GATCCTGAGTTCTTCCTGCACTCAGCAAGCATATCCATGTAGAACTGACA
CTTGCTGATGTCATTTCCAAAGTTGTTGATGCAATCTTGGAATGCCTTGG
AGTGGATGCCGCAGGCATCAGCACTGGCAAAACTGTTTGTGCCAGGAGCT
GGGGCAGAAGCTGCAGCCTCAGAAACCACAGTTTCATGCTGAATAGTACG
AGGACCCACGACAGCATCGACTGCTCTGTGTGCCACAGCACTTCCAGTAC
CAAATGCCATACCCTGAGCTATGGTAGAGCCGATGCCTCCAAGCATACTA
CCACCGCTCTGAGCAGGAGCTGGAGGAGGAGCATGATGAACTGGCTTTGG
GGGTGGGCTGCGTGCAGCAGGACGAGGGGCAGATCTTCCTCCGGAGCT
back to top