CB304539

Overview
NameCB304539
Unique NameCB304539
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length266
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IVaR_D02 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IVaR_D02 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304539 ID=CB304539|Name=CB304539|organism=Citrus sinensis|type=EST|length=266bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGACAGAAATATCAAGTAGAA
CAGTTTCATATAATATCCTTGGTGAAATTGCAATTAGCCTATCGTCCAAC
ATTCATGTTCGTGTCGCGAAGACTTTTTGACTACTAATTAAGCTGGAAAT
CTGGCCAAAATGGGACTGAATTATAAAATTAGAATACAGACAATATATAT
TTCCTCTTCTAGTGATACTGAAGACTGGTATAATTGCTCATTTCAGCCTA
AATGAAAAAAAAAAAA
back to top