CB304541

Overview
NameCB304541
Unique NameCB304541
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length627
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
CB304541_ssr60 microsatellite CB304541_ssr60:60..71.
Csv1_Contig9189 contig Csv1_Contig9189:807..1432. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IVaR_D04 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IVaR_D04 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304541 ID=CB304541|Name=CB304541|organism=Citrus sinensis|type=EST|length=627bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCCCACAACATTACATTATA
GTCAACTCTTTTATTTATTTATGGACTAGACTTAGAAGAGCTCTGCTCGT
TACAACACACTTGAATCCTTTTTATAAGCATATTAAAGGATCCTCCAACA
AAACATCAATTACAATCATTACACAAACGATAATATTATCTAGAGGTAGT
TAAATTACACAATACATTGACACAACTATATGTCCAATCCTAAGTTTATA
TTAGATAATACCATTAATACACACATCAACTTATCTCACCGTACAATATT
CAATTCGAGTACAAGTTCCAAAACACTTGACCATCAAAAGTATGATCAGA
ATCCACAACATCTCCTCCGTGAAAAACCTCTAAAAGATTAATCTCCAAAA
CAAGAGAACCTCCGCGCAACACTTCACGATCATATTTCAATTTGTTCAAT
GGAACTGTAGTTCTAACGCCATGAAAAGGACGATCCTTTTTATCATCACC
TATAGGCTTATAACCATTAGAAGAACCAGATGCAGTAACACAAAGCGAGC
TAGCGGGGTCCATATTATTGACACTTGGAGGAGGTAAATTTTTTCTCCAA
TTACTCTCCGGCTCGTGGGGAACAACT
back to top