CB304549

Overview
NameCB304549
Unique NameCB304549
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length402
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2614 contig Csv1_Contig2614:293..693. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IVaR_D12 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IVaR_D12 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304549 ID=CB304549|Name=CB304549|organism=Citrus sinensis|type=EST|length=402bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCATTAAACCACACAAGGCC
ACGGGCATGGCCATGGCCATATATTACATGATTATGAAGAAGGAAACACA
AAACATTACGAGTGATGGGTGACACAACACGCACACCACTCCACACACTA
GTAGTAGACCATCATAAAAACGAAGTAAAGAATTTTTCTTTTTTTTTTTA
ATCAGCCTTACATTATTCTTAACCCCCACAATATTTAGGCACACTTGCAG
CTTCTTATTTTTTGCTGCATGGGTTTGCTTATTAGTGACTACCACAAGTG
CAGTTCACACAAGCGCAGGTGGGGCCGCACTTGCAGTTACCTTCAGCCTC
AGCAGCCTGAACGTCCATGACAACAACGGTGCTGACAAAGCTCAAGTCAG
TC
back to top