CB304560

Overview
NameCB304560
Unique NameCB304560
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length530
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2537 contig Csv1_Contig2537:1260..1789. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IVaR_E12 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IVaR_E12 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304560 ID=CB304560|Name=CB304560|organism=Citrus sinensis|type=EST|length=530bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATATATACAATCTAGAACTAA
CCAACTTCAAAAAAGTAAACCTATTTACAGGAGCATCCAGAACTCCTCCT
ACTTCATTCATCTGCAATGTCAAGATTAAGAATGCGACGCAAAGTCTTGG
TCGCAGAGTCAGCACTGAGAAAAATATCTCGAGTAAAGTTACCATGCTTC
CTAGTTGGTGATGCCGGTGCAGACTTGGCAATCGGGTGGGGAATTTCAAT
ATCAGACGCATCATTAGTGACAGGCAAATCAAGTGACACAGTGCGTTTAG
GCCTCATAAAGAATTTGGGAATCGGCAAAGAACTCGGCGGTGGCGAGTTG
GAATAAGCAGGCCCGGCCCACAGCTCAGAGTAAGAAAAAGTTTCAAATTC
ACTAGAGATTTTTTCATTAAAAGATCTCTCATAGTTTCGAGATTTGAAGT
TAATGCCAATTGGGTTGCTCTTGACACCAGTTTTTGACTTGGTTGTGCCA
TCAAAACATTGAGAGTTATGGCTAACACTT
back to top