CB304572

Overview
NameCB304572
Unique NameCB304572
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length396
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig349 contig Csv1_Contig349:1..396. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IVaR_G07 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IVaR_G07 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304572 ID=CB304572|Name=CB304572|organism=Citrus sinensis|type=EST|length=396bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGATCAAATAACCATATATCT
TGCTTTATTAACCCAAAAATATTATACAGGGATGCTGATTTACAGAAAAT
CAAAGTTCAACTAGCATATTAAAGAGCTTCCATTCGTTTAACATTGAAGA
TTAAAATACAATATATAGGCTTTTAAAACTTCTACTGACGTGACAGTTTC
AAAGTAAGCGTTTTCAGACCCGACGGTAAATGTGAAAGGAAAAGGAGCCA
CTCTTAGCCACCACAACAGGAGCCACAGGCAGGTAAGGAACTATGGTCAT
TGCCACGGACATCATTTAGCCCTCGCACATTGTCAAGTCCGCGGGACGGC
CCACGTGGACCACCGCCACCATATGGTCCACTTCCTGGACCACCTG
back to top