CB304574

Overview
NameCB304574
Unique NameCB304574
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length147
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12567 contig Csv1_Contig12567:1452..1598. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IVaR_G09 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IVaR_G09 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304574 ID=CB304574|Name=CB304574|organism=Citrus sinensis|type=EST|length=147bp
TTTTTTTTTTTTTNNNTTTTTTTTTTTTTTCGCTCTTAATCACATCAGCA
CTTTCCCATTGGCTGATGCCTCAAGTTATAAACATACAAAGCAAAGAAAA
GGGAACAGCCCAAGGGCAGTCTTACACATAACACAGATAACAAGGAC
back to top