CB304630

Overview
NameCB304630
Unique NameCB304630
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length639
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IaR_F07 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IaR_F07 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304630 ID=CB304630|Name=CB304630|organism=Citrus sinensis|type=EST|length=639bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACAACGCAAATATATGTTCT
CATAGATAATCATACGCAGTTTCCTCCAGATGCGAAACAGTTAAACAATA
TCAAACGCACGAGGACTGATAGGAAGTGCATGGACTAATGTCACCATATC
ATGTATACCACACCCAGAACTATTATGAGCCACTAAAATTTCTTCCTTAC
AACTATAAAATAATTTTTTCCCCCTCACATTTCTTGCCCTTCCAACTCGT
AGCTCAAGACTTGGAGGTGTCATGAAGAGCATCCCTCAAGCCCCAGTTTA
GTTGTTAGCCAAGCACAGACCTCGTCCATCTCTTCAGGACAGGTGTAGTG
GCCAAGGCCACTGTAAGCTTTGAAGATCACATCCTGAAATGCATTTGAAG
TCAAGGCTTGCGAGGACTTCTCACCAAATTTATACTGAACCACATCATCA
CCTTTTCCATGGCAGAGCAAAATGGGCAAGGATGCAGCACGTCTTCTAGC
TTCATTTTCTCCACCTAGTTTGTTCTTCAAGGTCTTTGAGCAAGGAAGCC
AGCCACTCAGTCCTACAACTGCACTCAATTTAGCAGGGTATGGATTGCCA
TTCCCATATTTTCCATGGGCAAAGCAGGTTGCAGAGTAC
back to top