CB304632

Overview
NameCB304632
Unique NameCB304632
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length631
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1342 contig Csv1_Contig1342:441..1071. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IaR_F10 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IaR_F10 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304632 ID=CB304632|Name=CB304632|organism=Citrus sinensis|type=EST|length=631bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCAAGTGCTATGATATTGGAA
TTCAAAATGTCAAACATAATATAGGATTTGTATCTGCCTGAGATTCTTCT
TACCTGATATAACTAAAGCTGATAAGCATGGGACTATGAACAAAAACAAG
ATTAAGGCAGAAAACTGTTCATCTTGAGACATATTACCACCTTCGAACCA
GTGATGTGAGCAACTCAAATAACTCAAATGGGTTGCCGCGACGGTACACA
TCATTTTTCTTGCTCTTATCATCTGGAAGAAAGCTGAGCAATAATGCTCT
CCATCCAATGAGTAAGACAGCAGTGGTTCCCATTGTTACTAAGATGAAGG
TATATGGTGGAAGATGGCCAGATGTTACTGCCCTTATAATTAACCCTAGT
GGAACCCCAGCAGCCCATGATTTAGTGGCAGCAACAACGGCCTTTGAGAG
ACCATTCATTCCACGGCCGTCTTCCGCATAACCCCCAAGAAAGTAAGCAC
TTAAGAACCACCCAGCAATAAAAGGATCAGCAGTACGCAGAGTATCAAAG
TCAAAGACTGAGAAGCCATGATTAAACCTTCCAATTGCAGAGAACAAAAG
CAACGCCAACACATCCCCGCCAGAAAGCAAA
back to top