CB304636

Overview
NameCB304636
Unique NameCB304636
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length177
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IaR_G05 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IaR_G05 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304636 ID=CB304636|Name=CB304636|organism=Citrus sinensis|type=EST|length=177bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTGGCACAATTATCATGTTTTCTT
CTAAATTTTGAAATTTAGGGCAAATTTTATATTAAAACAAAGTATTACAT
CAATGTATTGAAAAAACACATGATATTAACCTTAACTCCCAAGAGGGGCT
TCCTCTCGGGTATCAATGTCTAGGCAT
back to top