CB304637

Overview
NameCB304637
Unique NameCB304637
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length206
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IaR_G06 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IaR_G06 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304637 ID=CB304637|Name=CB304637|organism=Citrus sinensis|type=EST|length=206bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCTAACAGTCATGACACGGTA
TGCATTGATATCAGAATTGCGGCAAACCATTAATCTGGCATGAAGATAGT
ATGGTTCATCATGTGGGTTTGGCAATTTAGACACCAATATAACTTATAAA
TTCTATGTTAAACTTATTTATTATCTATGGTTAAAATATAATTCATATTC
TCTAAT
back to top