CB304642

Overview
NameCB304642
Unique NameCB304642
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length611
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IaR_H03 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IaR_H03 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304642 ID=CB304642|Name=CB304642|organism=Citrus sinensis|type=EST|length=611bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAAAAAAGATGCAAATTTTTC
TATATGATCAATTTTTTTCTCTTATTGATGCCATGATACAAACCATACAT
TCAGGAATACAGAAATTTGATACTAATTATGCCATAAATCTTTCGCATGG
TCCTTCATTCTTCAGCCCAGGTTACTGCCACTGGGCGTCTCCTTTCAAGA
ATTGGGGTTTACAGTTTCTTTTCTAAGCACAAAGGGGGAATCTATTAATC
TAAGTCCATATTTCTTCTGTATTCTTCTTATTGTTAGTTCTGCAAAATGG
TCTCTCAACAGGGTGCAAAGACCAAAAAATTTAACAGGGATAGCACCTTT
ATACACTCAAATTATCACAAAAAATCATCTGCATTGTTGACACAAAGCTC
TTATATTCAGCAAGTTCTTATCAGCTTTTGTCTCCACTTCCAAAACAATG
TACCACTTTCTCTGGTTTTTGATTCTATGATCCTTCTCTTATGTTTTGTT
TTAGTATGGTCGGGAGTTTCCCTAGATGTTGAACTCCTCAGGGGTCGTCG
AGGACTGCCAGCTTCCGCTGATGCATCTACAATCTTGCTTACCATTTCCA
ACACTTCACTC
back to top