CB304654

Overview
NameCB304654
Unique NameCB304654
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length355
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
CB304654_ssr223 microsatellite CB304654_ssr223:223..232.
Csv1_Contig2589 contig Csv1_Contig2589:764..1117. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IIIaR_A05 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IIIaR_A05 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304654 ID=CB304654|Name=CB304654|organism=Citrus sinensis|type=EST|length=355bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGTAATTGCTCAGCAGTCAC
AATAATTCAGAACAAATTTGGTTTTGTGGGGACTTGTAATGATTCACAAG
GCAATTTACACACTCAATAATACTCCACTTTACATCAACATATTGAATTA
AAATTCATTAAAAAGGACAAATGAAAGAAAAGAAAACGATAAAGATTAAC
AAACGAAACAAGTGCTCTCTCCCACACACACACGCACACCCCAGTTGATT
AAAAATCAAAACCCATCTGGCTACATCAAATCAAAGCTGCCCATCTAACG
GTTGTAAATAAAAGATCTCATAACACATGATGCCCTTGGGATCTCTCAAT
AAATG
back to top