CB304661

Overview
NameCB304661
Unique NameCB304661
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length268
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
CB304661_ssr230 microsatellite CB304661_ssr230:230..241.
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IIIaR_B03 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IIIaR_B03 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304661 ID=CB304661|Name=CB304661|organism=Citrus sinensis|type=EST|length=268bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCTGTTAATTTTTTATTC
AATTCCCCAGAAACCTTGTTTAAATATGCTAATGTTGCCGCAGCCTGCGG
GTAGTTGAATCGTGTGGGGTGAATAAAAAGTTAGCAAGCCTGTGTTTTTT
GGGAAATTTACAAATCCCCGACGTTCCATCGCTCTTAAGGGCAAATCTGT
CTTTTAACTATTTTCACTGTGTGAGTAGTGGCCGGCCGGCCATGTTCTAT
AAGCAACTGAGCGTTCCC
back to top