CB304674

Overview
NameCB304674
Unique NameCB304674
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length107
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IIIaR_C07 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IIIaR_C07 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304674 ID=CB304674|Name=CB304674|organism=Citrus sinensis|type=EST|length=107bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCGCGAAATTATAATGAATAA
CAATGACAATTTCCTGTTAGAAAATACATAGAGCTAAAATTTAAAAAAAA
AAAAAAA
back to top