CB304733

Overview
NameCB304733
Unique NameCB304733
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length317
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IIaR_A12 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IIaR_A12 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304733 ID=CB304733; Name=CB304733; organism=Citrus sinensis; type=EST; length=317bp
TTTTTTTTNNTTTTTTTTTTTTTTTTTTTTTAGATAGATAATAACTGTAC
CCATCTTTTTATTTAATTATATATATCATCATCCAGATTGCAGACACTTA
CCCATAATAATCAGGATTTCTCCCATATTGAGGAATAACAATAAGATCAA
GATTGTCATTCCTAACATCATCATCAGCAATACTGGAAGGGGGGAGTAAG
TAACCTTCTGACGGATCGCTCATACCTGCGCCAGGAAGAGTTTTCATATT
CTTCAAGTCAGAAAAGATATTTGCTAGCTTCGAGTGCACTATATTAAAAA
ATAAGTACTTGAGCCCC
back to top