CB304741

Overview
NameCB304741
Unique NameCB304741
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length624
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IIaR_C01 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IIaR_C01 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304741 ID=CB304741; Name=CB304741; organism=Citrus sinensis; type=EST; length=624bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCAACGTTGTAAATTTATTA
TACAGTACATGAACCAAACACATTTTACAATATAGATAAAAGTCTGAGAG
GAAGCTTCCCATTAGAAAAGCAGCAGTAACAGATACACTTAATGATTAAT
TAACTAGCCATGGATCTGCAACAAACCCAGTTAAGGATTCGGAGAAGCAG
CCATGGCTGGTTTTTATTTTACAAACAAAAGCTCATAAAAAGACATCCAA
CAAAGCCAACCACAAAAGACAAATAGTTCTTTTTATTGATACTACAATTT
AAGCGACCTCACAGCGCTGCTTTATTATGGGGCATGTTCACGTCTCGTAA
TCTTCATTAACAGTTACAAGGGTTGCACTTGCAGTTTGGTCCACACTTGC
AGCCGCCCTCGGCTCCGAATCCCATCTCGGATCCCTCAGAGTGCATCTTG
ACAGGAGCAACACCGAGGACGAGGGTCTCGGTGGCGACGGTGGTGCTCTC
AAAGGATCTCAAGTCAGGGTACATGGCGCTACCGCCGCAGCCGCCGCCGC
ACTTGCAGCTAGAACCACAGCCACAGTTTCCACCACAGCCAGACATTTTT
TGTTTTCCTTTGGTGATATAACGA
back to top