CB304742

Overview
NameCB304742
Unique NameCB304742
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length642
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IIaR_C02 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IIaR_C02 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304742 ID=CB304742; Name=CB304742; organism=Citrus sinensis; type=EST; length=642bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCGGAAGAAAATAAACAAAC
TTTATTTGAACTCAGAAGTCTTTTAACATTCTGATAGAGCAAACAGTTTC
CACAAGCTCTCAATGATAATTTTAAAAGAAATTTTAAAACAAAATTACAA
GATATAAATACCTCCATTTCATTAAGCATCCAACAGTCAAAGGGACATAT
GTCTAAAAGCTGACAAAAATTCAACACAACTAGAAGCATATCTCATTCCA
AAATGGCAACATTAAACCCGCATGTCTTATTGCTACAAGCAATTCTTGGA
TACTGCTACCTAGGTCCAGGTCTTTTCACTGTCTGTATGTCCCCAATAAA
GCTTAATCTTAAGATGATGAAACAGGTGCTTCAGTCTCAGGATTTGAAAC
AGCAGCAGCAGCAGCATTATCTGCCGAGGGTGGTACATAGATACGTGCTT
TCTTTAGAATTTCGGCAACAAGCCAATGCTTATGCTTGCTTAACGGTCTA
GAAGGATCCAACCTAACCTGAAGCCACAGGCTCGAAACATAAACCCCATA
ACAATGGTATCCATCAATGAAGCAGTTGAAACGATTGCATATCAAATGGG
ATTCGGAAAATGACTGATACAAGTGAAAACACCCATCATTAC
back to top