CB304752

Overview
NameCB304752
Unique NameCB304752
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length575
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IIaR_D05 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IIaR_D05 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304752 ID=CB304752; Name=CB304752; organism=Citrus sinensis; type=EST; length=575bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAACAAAAGGAATAGCTTAAT
ATATACTGATAATAATCATAAGTCTCCAAAATAACAAACATAAATCAAAT
CATATCATCACATCTCCGTGAGCTACAAAGCATAACTGATAACTCTCTCT
CATTATAAAATTTATATGTAATAAGACTCACTCCCTAAAAGACTAAAAAC
CCAGGGGATCCGCCGCTACTAAGCCCACATAACGTCTAAACAACGCAAAA
AAAGAAAAAAAAATGAAGAAACCACTCTACACACCCAATAAGCTAGTGAC
ACGTAATCAGATAGAGAACCGGCCTCTTAAACCCTGAGAACTGTGCCGAA
CACCAGAGCGGAAAGGAGAGCGACACCAGCGGCGGCTAAGGAAGGCGAGA
TCGAGCCGGCTCCGGAAGCGGGAGCTGGAGCGGGAGAGAGATCTTGAGCC
GACCCTGCGAGAACCAAGGCGGCCAGGACAACGGCCATCATCAGCGTAGC
CATTGAAGCCTTTGAGAATGCCATTATTGAAGCCTTTTTTTCTCAGGGTT
TTTGAGAGCGTAACCGAAGGAAGCT
back to top