CB304753

Overview
NameCB304753
Unique NameCB304753
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length107
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IIaR_D07 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IIaR_D07 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304753 ID=CB304753; Name=CB304753; organism=Citrus sinensis; type=EST; length=107bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTACAATATAATTGATAATGGAA
ATTCACATTGACAAAAGGCAAATTACACACTGACTGGGCAAAATAAATAA
AAAAAAA
back to top