CB304795

Overview
NameCB304795
Unique NameCB304795
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length499
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9188 contig Csv1_Contig9188:557..1055. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IVaR_A07 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IVaR_A07 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304795 ID=CB304795|Name=CB304795|organism=Citrus sinensis|type=EST|length=499bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCGATAAAAGGATAAAATCT
TATTAACAAGAGAAGAACCATGAAAAGTTCTGTAGTGCAGCAGTCCACTC
ATTACATCATACTGAAATAAAAAACAAAACTATAAGACCATACAAATGAA
ACTATAACAACTTCAAATCTCCAAGAATGAAGAATGAAGAATGAAGATAT
ATACTGACATTGTTTAATGAAAGAAACCCACAAAGATGCCAAAAACAAAC
TTTGACCCATCATCCGGATATGGTTTCAGGCATCGGCGAAACTAAACTAA
ATAACAAGAAAAAGCAATTATTTAATAATTCAAGAGGCAGTTTTCTTTTC
CAGGATGACTGAGTCTATATCTAAGGTTGACCATCACTCATGCTCAAACA
GATCGCTTAAATGCAAAAGGTATGGCGGAAATAGGCAACACACAAAGAGC
ACCAATAAGCCATATCATGAGATTTTCAGGGAATAGCATCCCCNGGATT
back to top