CB304816

Overview
NameCB304816
Unique NameCB304816
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length191
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IVaR_D05 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IVaR_D05 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304816 ID=CB304816|Name=CB304816|organism=Citrus sinensis|type=EST|length=191bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTGCCAACAACGTAATACCTT
GTATTACAGGCTTACGGCTTGCCCGGTGCCTAGGCTACCGACAGCGGCTG
TGACATAACTTCCAAAAATGTTTCAATGATTAATTTGAAGATTCACATTG
ATTCTAACACATAATGGACAATGAAACAGCATGTTGGCAAA
back to top