CB304820

Overview
NameCB304820
Unique NameCB304820
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length158
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IVaR_E01 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IVaR_E01 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304820 ID=CB304820|Name=CB304820|organism=Citrus sinensis|type=EST|length=158bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGGGGTGCAACACGAGGACT
TCCCAAGAGGGCACCCATCTTAGAACTGCTCTCGCCCAAGCACGCTTAAC
TGCGGAGTTCTGATGGGAACCGGTGGATTAATGATGGTATGGTCCCACCC
CCCGGCCG
back to top