CB304857

Overview
NameCB304857
Unique NameCB304857
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length227
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_B06 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_B06 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304857 ID=CB304857|Name=CB304857|organism=Citrus sinensis|type=EST|length=227bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGAAGAAACAATACATGAAG
CGCATGGGAAATTCATAGCTTCCTCAATTGAACTTTGCAAAACTCGACCA
TCTGAAATCTAAGCATTTTGTTTAGTCTATGACAAGCAAATTTCATTTGC
AATCAAAATCCGGAACAAAATGGCAATCTGATAATATAGATCATAATATA
GATCAGCAGCTGGCCGTTTCGGTAACC
back to top