CB304859

Overview
NameCB304859
Unique NameCB304859
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length176
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7914 contig Csv1_Contig7914:625..780. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_B09 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_B09 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304859 ID=CB304859|Name=CB304859|organism=Citrus sinensis|type=EST|length=176bp
TTTTNNNTTTTTTTTTTTTTTTTTTTTTTTTGGAAACAAACACAACAGCT
TTTTGACTGACATAAAAATAAACTCATATCCAAGCCACATAACACCTCTT
TAAACTACACATTAATCCCATTATCTAAATTAACAACTGAAACGCTAGTA
TTTAGTCCAACAACAAAAAAAAAAAA
back to top